LOC100329415

Ensembl ID:
ENSDARG00000075899
Human Orthologue:
LPHN2
Human Description:
latrophilin 2 [Source:HGNC Symbol;Acc:18582]
Mouse Orthologue:
Lphn2
Mouse Description:
latrophilin 2 Gene [Source:MGI Symbol;Acc:MGI:2139714]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39742 Nonsense Mutation detected in F1 DNA During 2017
sa32822 Nonsense Available for shipment Available now
sa39741 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086761 Nonsense 39 534 2 6
Genomic Location (Zv9):
Chromosome 2 (position 1586812)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1407606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTTTTCAGGGTTCAGTCGTGCAGCGCTGCCGTTTGGTCTGGTGCGC[A/T]GAGAGTTATCATGTGAGGGCTATCCAATCGACCTGCGCTGCCCGGGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086761 Nonsense 202 534 4 6
Genomic Location (Zv9):
Chromosome 2 (position 1565951)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1428467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTACGCATCACTGGACGATCTACGAAGTGGTCGACAAACGACCACATA[C/A]AAGCTTCCACATCGCGTAGACGGAACTGGGTTTGTAGCCTACGACGGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086761 Nonsense 493 534 5 6
Genomic Location (Zv9):
Chromosome 2 (position 1529460)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1464958
GRCz10 2 1477379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATCTCCTGGCCAAAAACACACCGCGGGCTGACAGTGGAGCGGCCCTG[T/A]CCCAGAGGAACACGAGGTGTGTCTTCGGGTCATTCCATTATTATAAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link