bat3

Ensembl ID:
ENSDARG00000075892
ZFIN ID:
ZDB-GENE-010501-5
Description:
large proline-rich protein BAT3 [Source:RefSeq peptide;Acc:NP_958445]
Human Orthologue:
BAT3
Human Description:
HLA-B associated transcript 3 [Source:HGNC Symbol;Acc:13919]
Mouse Orthologue:
Bat3
Mouse Description:
HLA-B-associated transcript 3 Gene [Source:MGI Symbol;Acc:MGI:1919439]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14864 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110964 Nonsense 471 1209 11 25
Genomic Location:
Chromosome 15 (position 33936931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTGATATGTTTTAGATTCTGGAAATGCTGCYCCRCCTAATGGACAA[C/T]AGAATGGGACTGGCACAGGACAACCTGGTTAGTTTTTGGATGGACTGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lung adenocarcinoma: A genome-wide association study of lung cancer identifies a region of chromosome 5p15 associated with risk for adenocarcinoma. (View Study)
  • Lung cancer: Common 5p15.33 and 6p21.33 variants influence lung cancer risk. (View Study)
  • Lung cancer: Deciphering the impact of common genetic variation on lung cancer risk: a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tc3p9ifg