bat3

Ensembl ID:
ENSDARG00000075892
ZFIN ID:
ZDB-GENE-010501-5
Description:
large proline-rich protein BAT3 [Source:RefSeq peptide;Acc:NP_958445]
Human Orthologue:
BAT3
Human Description:
HLA-B associated transcript 3 [Source:HGNC Symbol;Acc:13919]
Mouse Orthologue:
Bat3
Mouse Description:
HLA-B-associated transcript 3 Gene [Source:MGI Symbol;Acc:MGI:1919439]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35957 Nonsense Mutation detected in F1 DNA During 2016
sa14864 Nonsense Available for shipment Available now
sa28504 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32052 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110964 Nonsense 359 1209 9 25
Genomic Location:
Chromosome 15 (position 33937545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGGTGGCCCTAAGTGACTTGCGCTGCAACCTCCTGAGCAATCCACCA[C/T]GACACCTGCATGTCATCCGGCCCATGTCCCACTACACCTCCTCTGTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110964 Nonsense 471 1209 11 25
Genomic Location:
Chromosome 15 (position 33936931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTGATATGTTTTAGATTCTGGAAATGCTGCYCCRCCTAATGGACAA[C/T]AGAATGGGACTGGCACAGGACAACCTGGTTAGTTTTTGGATGGACTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110964 Essential Splice Site 1038 1209 21 25
Genomic Location:
Chromosome 15 (position 33922121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATCTGTACAAAGGCCTACGCCGGATCCAGAGCCTCAGAATGTGGAGG[T/A]AAATCATTTTGAAGTCTCAGTTTTGGGATGTACTGCAACTGGACAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110964 Nonsense 1178 1209 24 25
Genomic Location:
Chromosome 15 (position 33918074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTAGAAGGGGACTTAGAAAATCCTGAGCTTCAGGAAGCCTACAATGAA[C/T]AGGTATCTTGAGTGGAAAGTAATCATGTGTTTTTCTTTGGTTTGTATTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lung adenocarcinoma: A genome-wide association study of lung cancer identifies a region of chromosome 5p15 associated with risk for adenocarcinoma. (View Study)
  • Lung cancer: Common 5p15.33 and 6p21.33 variants influence lung cancer risk. (View Study)
  • Lung cancer: Deciphering the impact of common genetic variation on lung cancer risk: a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link