sall1b

Ensembl ID:
ENSDARG00000075891
ZFIN ID:
ZDB-GENE-020228-3
Description:
Putative spalt protein [Source:UniProtKB/TrEMBL;Acc:Q9DGH2]
Human Orthologue:
SALL1
Human Description:
sal-like 1 (Drosophila) [Source:HGNC Symbol;Acc:10524]
Mouse Orthologue:
Sall1
Mouse Description:
sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3306 Nonsense F2 line generated During 2017
sa32545 Nonsense Available for shipment Available now
sa44357 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa3306
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113815 Nonsense 223 1217 3 4
Genomic Location (Zv9):
Chromosome 25 (position 37079085)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35486701
KASP Assay ID:
554-3046.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAAAGGTTGATTTGGGTTTRATCGAGCAGCTGTTAGCATTGCAACAA[C/T]AGCAGATGCAACAGCTAAAACTAATTGAAGAAATACGCGCCCAAATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113815 Nonsense 550 1217 3 4
Genomic Location (Zv9):
Chromosome 25 (position 37078103)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35485719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTTGCCAGGTCTTCCAGTCATTATCAAAAAAGAGGAGGAAGGGGTAT[C/A]GATAACCAAACCTCATAGTCCTGTTGTCAGTGAGCTAACTAAGAGAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113815 Nonsense 812 1217 3 4
Genomic Location (Zv9):
Chromosome 25 (position 37077318)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35484934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAGAAAGTGAATGCTCTTCGCCGGCTTCATCAGTGTTTGCCAGATCA[G/T]AGAGTCAGATCAAGGTTACGAATGTGGAGAATTTGGAGAACACTAGTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link