si:ch73-190m4.3

Ensembl ID:
ENSDARG00000075887
ZFIN ID:
ZDB-GENE-090313-139
Description:
probable E3 ubiquitin-protein ligase HERC3 [Source:RefSeq peptide;Acc:NP_001139096]
Human Orthologue:
HERC3
Human Description:
hect domain and RLD 3 [Source:HGNC Symbol;Acc:4876]
Mouse Orthologue:
Herc3
Mouse Description:
hect domain and RLD 3 Gene [Source:MGI Symbol;Acc:MGI:1921248]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8570 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39689 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112994 Essential Splice Site 421 1046 9 24
ENSDART00000141977 Essential Splice Site 421 1046 10 25
Genomic Location (Zv9):
Chromosome 1 (position 51167481)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50016572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGCTGGAGGATGAAGCTTCATGACAACWGCGATTCCAGCATCACTAA[G/T]TGAGTGTGTGACATCATCCCCATYGATCATAATAATGGCCTCACTAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112994 Nonsense 842 1046 20 24
ENSDART00000141977 Nonsense 842 1046 21 25
Genomic Location (Zv9):
Chromosome 1 (position 51189980)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50039071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTTTTGTCTGTGTTTTGCCAGGAGTTTGCAGCAGCTGCTGGAGTTT[G/T]AGGGTGATGTGGAGGAAACCTTCTGTCTCAACTTTGCCGTAAGTTCATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link