SHPRH

Ensembl ID:
ENSDARG00000075884
Description:
SNF2 histone linker PHD RING helicase [Source:HGNC Symbol;Acc:19336]
Human Orthologue:
SHPRH
Human Description:
SNF2 histone linker PHD RING helicase [Source:HGNC Symbol;Acc:19336]
Mouse Orthologue:
Shprh
Mouse Description:
SNF2 histone linker PHD RING helicase Gene [Source:MGI Symbol;Acc:MGI:1917581]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42868 Nonsense Mutation detected in F1 DNA During 2017
sa22999 Nonsense Available for shipment Available now
sa36315 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112878 Nonsense 328 883 8 21
Genomic Location (Zv9):
Chromosome 17 (position 7405325)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7408099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGAACTCTGAGGTTTCTGAAGCACATCAAAACCTACAGCCTGTTCTT[C/T]AGCACATTAAAGAACAAAGACGCAAGGTAGACGCTCGGTTATTACATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112878 Nonsense 374 883 9 21
Genomic Location (Zv9):
Chromosome 17 (position 7407735)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7410509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATGATCTTGTCAGCCGCATTCAAAATGAGCTTACATGCAGTTATAAA[C/T]AACAAGCCAACAAGCTCTCAATGGCAGACAAGTAATCCAGCATCTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112878 Essential Splice Site 825 883 19 21
Genomic Location (Zv9):
Chromosome 17 (position 7426265)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7429039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCACGAGCTGCAGGCCATAGGAAGAGTGCATCGGATTGGCCAGACCAA[G/A]TAGGAAACAAACCAATTTTCAATCATATGTCCACTTCTATTCATATTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link