LOC797480

Ensembl ID:
ENSDARG00000075867
Human Orthologue:
MKL1
Human Description:
megakaryoblastic leukemia (translocation) 1 [Source:HGNC Symbol;Acc:14334]
Mouse Orthologue:
Mkl1
Mouse Description:
MKL (megakaryoblastic leukemia)/myocardin-like 1 Gene [Source:MGI Symbol;Acc:MGI:2384495]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25248 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20004 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10921 Nonsense Available for shipment Available now
sa6887 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25248
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111769 Essential Splice Site 54 1030 2 16
Genomic Location:
Chromosome 3 (position 25015955)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTTAGTCATTTTACTGCCCTTCATCTTTGAATTCTTGTTTCTTTTTA[G/A]TGCTCCAACTCAAACTTCAGCAGAGGCGAACTCGAGAAGAACTGGTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111769 Essential Splice Site 120 1030 4 16
Genomic Location:
Chromosome 3 (position 25032213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGTCGTCCAGAGAGGTCAGAGCTGGTCAGGATGCACATTCTCGAAGG[T/C]GAGTGTTTTCATTACTCCCCCTACAGTTCAAACACGCACACACACCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111769 Nonsense 288 1030 8 16
Genomic Location:
Chromosome 3 (position 25040122)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTCTAAGAAAGTGAGAGACAATAAACCTAAAGTCAAGAAKCTGAAAKA[T/A]CACCAGTATGTTCCTCCGGATCAGAAAGCKGAGCGTGAGCCYCCGCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111769 Nonsense 668 1030 11 16
Genomic Location:
Chromosome 3 (position 25045643)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCAGCAGAGGATTGTAATGCGACAGAATCAACGCAACCTGCTGCAA[C/T]AGACACATCAGAGGAAGAGGAAAACACAGAAGCAGCAGAGACAAGTTAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)
  • Height: A genome-wide association study of northwestern Europeans involves the C-type natriuretic peptide signaling pathway in the etiology of human height variation. (View Study)
  • Treatment response for severe sepsis : Beyond single-marker analyses: mining whole genome scans for insights into treatment responses in severe sepsis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k2d299r1