si:ch211-136o4.1

Ensembl ID:
ENSDARG00000075864
ZFIN ID:
ZDB-GENE-060503-288
Description:
cDNA, clone cssl:d0672 [Source:UniProtKB/TrEMBL;Acc:B0CLZ6]
Human Orthologue:
IGSF9
Human Description:
immunoglobulin superfamily, member 9 [Source:HGNC Symbol;Acc:18132]
Mouse Orthologue:
Igsf9
Mouse Description:
immunoglobulin superfamily, member 9 Gene [Source:MGI Symbol;Acc:MGI:2135283]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10840 Essential Splice Site Available for shipment Available now
sa17448 Essential Splice Site Available for shipment Available now
sa21707 Essential Splice Site Available for shipment Available now
sa24866 Nonsense Mutation detected in F1 DNA During 2017
sa34879 Nonsense Mutation detected in F1 DNA During 2017
sa17395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Essential Splice Site 20 1619 None 21
ENSDART00000137456 Essential Splice Site 20 767 None 17
Genomic Location (Zv9):
Chromosome 10 (position 19069813)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19082159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAACCTTCCTCTGTTGGAAGTCATTGTTGCAGTTCTGTGCCTATTCAG[T/A]GAGTATTTTACAGTATCTACTTCACAACTGACAGATGCACAATCATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Essential Splice Site 84 1619 2 21
ENSDART00000137456 Essential Splice Site 84 767 3 17
Genomic Location (Zv9):
Chromosome 10 (position 19072556)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19084902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTCATGCAGCTCGGAGTTCATCCTCGAGTACATCCTGACTATGATGG[T/C]AAGAACGTCTAACTTATGATGTATTTRAYACTATGTTATTATTATTAWTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Essential Splice Site 184 1619 4 21
ENSDART00000137456 Essential Splice Site 184 767 5 17
Genomic Location (Zv9):
Chromosome 10 (position 19090615)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19102961
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTGGTCCAAAGACGGAGCACCAATAAAACCTCAACACAAAGTAAAGG[T/G]CAGAATGAAGCACTTTAAAACCTTACGAAATACTGAACAGCTGCGATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Nonsense 346 1619 8 21
ENSDART00000137456 Nonsense 346 767 9 17
Genomic Location (Zv9):
Chromosome 10 (position 19101411)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19113757
KASP Assay ID:
554-7599.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGACCTTCCTCCCCACTGGCATGAGGGGTGCGATTGTGTGCCCTGTC[C/T]GAGCTGAACCTCCATTATCACACATCGACTGGATCAAAGACGGCAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Nonsense 745 1619 16 21
ENSDART00000137456 Nonsense 752 767 17 17
Genomic Location (Zv9):
Chromosome 10 (position 19113156)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19125502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTGGGACTCCTTTGCCTCGTTCTTGTCCTGACCTTGGCGATAGCTTG[T/A]TTCATTTCTTACAAAAGAAGCAGAAGGCGCAGGCAGAATATTAAGGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111952 Nonsense 1566 1619 19 21
ENSDART00000137456   None 767 None 17
Genomic Location (Zv9):
Chromosome 10 (position 19116163)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19128509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGARCAGCATTACTAAAGATGATGACAGTWCAAATTTAGACCAAAAA[C/T]AAMAAGGTAAGAAAAATGWTAGCCTTGTATGTTGTAACACTAAGGGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link