si:ch73-341p18.7

Ensembl ID:
ENSDARG00000075855
ZFIN ID:
ZDB-GENE-090313-152
Description:
Novel 7 transmembrane receptor (Secretin family) domain containing family [Source:UniProtKB/TrEMBL;A
Human Orthologues:
EMR1, EMR2, EMR3, EMR4P
Human Descriptions:
egf-like module containing, mucin-like, hormone receptor-like 1 [Source:HGNC Symbol;Acc:3336]
egf-like module containing, mucin-like, hormone receptor-like 2 [Source:HGNC Symbol;Acc:3337]
egf-like module containing, mucin-like, hormone receptor-like 3 [Source:HGNC Symbol;Acc:23647]
egf-like module containing, mucin-like, hormone receptor-like 4 pseudogene [Source:HGNC Symbol;Acc:1
Mouse Orthologues:
Emr1, Emr4
Mouse Descriptions:
EGF-like module containing, mucin-like, hormone receptor-like sequence 1 Gene [Source:MGI Symbol;Acc
EGF-like module containing, mucin-like, hormone receptor-like sequence 4 Gene [Source:MGI Symbol;Acc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7415 Missense Mutation detected in F1 DNA During 2017
sa6607 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110119 Missense 68 162 3 3
ENSDART00000148075 Missense 80 595 3 12
Genomic Location (Zv9):
Chromosome 1 (position 56278208)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55060754
KASP Assay ID:
554-4005.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACCCCCCATCATGTGTGATGCYTCAGTCTCCTGGAGCGGCTGGTATC[G/A]GCTCTTCATTAACGGTCTGAGYGCTCATRTCCCAGACACATGTGTTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110119   None 162 None 3
ENSDART00000148075 Essential Splice Site 567 595 12 12
Genomic Location (Zv9):
Chromosome 1 (position 56283355)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55065901
KASP Assay ID:
554-5410.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCATCCATMTTTTTTCAGTSTTTATTTGATTGTATCTTACTTYAAACA[G/C]ATGCTGGATTAAAATGGATAAAGGCTTCTTCTGGAGTTTTKTGGGACCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Periodontitis: Exploring the genetic basis of chronic periodontitis: a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link