si:dkey-108d10.1

Ensembl ID:
ENSDARG00000075853
ZFIN ID:
ZDB-GENE-091204-186
Human Orthologue:
SH3KBP1
Human Description:
SH3-domain kinase binding protein 1 [Source:HGNC Symbol;Acc:13867]
Mouse Orthologue:
Sh3kbp1
Mouse Description:
SH3-domain kinase binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1889583]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16738 Essential Splice Site Available for shipment Available now
sa12980 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109809 Essential Splice Site 530 634 16 18
ENSDART00000143395 Essential Splice Site 565 669 16 18
Genomic Location (Zv9):
Chromosome 24 (position 26696842)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25755199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCGTGYTCAATGAACTGTTGCGCTGATGTCTCATGGGGGTTTTCCAC[A/T]GGTTCCYGAGAAATCATCTTTACCTCCTAAGCCCAGCGGTGTATCATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12980
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109809 Nonsense 565 634 16 18
ENSDART00000143395 Nonsense 600 669 16 18
Genomic Location (Zv9):
Chromosome 24 (position 26696950)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25755307
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGTCRTCTCTCCACCAGGGCGGCGCTGGACTGCGGCCTCATTCGCCTT[C/A]RGTTGATGCCAGAGGGAAGAGCGAACAGGGTCCCGTCACGCTGGAGGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link