PRR12 (1 of 2)

Ensembl ID:
ENSDARG00000075849
Description:
proline rich 12 [Source:HGNC Symbol;Acc:29217]
Human Orthologue:
PRR12
Human Description:
proline rich 12 [Source:HGNC Symbol;Acc:29217]
Mouse Orthologue:
Prr12
Mouse Description:
proline rich 12 Gene [Source:MGI Symbol;Acc:MGI:2679002]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33214 Nonsense Mutation detected in F1 DNA During 2017
sa13295 Essential Splice Site Available for shipment Available now
sa40094 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112009 Nonsense 63 1687 2 23
Genomic Location (Zv9):
Chromosome 3 (position 32571287)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32302597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTACCTGGCTCTGGCTCATTTCCCTCTTCCTCTGCTCTGTCGGCATA[T/A]CAGCACCCTGCATCCTTCTCAGGGCGCTCCTTCCCTGGAGTGGCCCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112009 Essential Splice Site 466 1687 3 23
Genomic Location (Zv9):
Chromosome 3 (position 32572591)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32303901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACATTCACCTGCCCTGATGGTGTCTGGAGGTGGTACTGGTACAACAR[G/A]TAGTACCACTGGTTCAGGAGCAGGGAGTTCAGGAAGTGTGGGAGTTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112009 Nonsense 1055 1687 10 23
Genomic Location (Zv9):
Chromosome 3 (position 32576024)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32307334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCGACATGAACAGAAATGATATGGGATGTGGTCAGGAAAAAATGAAG[C/T]AGAAAGCCCAAGAGGTGAGTCTCAGTTTGGAAAAATCTTTAGTGAATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link