si:ch73-173h19.2

Ensembl ID:
ENSDARG00000075846
ZFIN ID:
ZDB-GENE-081031-91
Description:
Novel protein similar to H.sapiens Kv channel-interacting protein [Source:UniProtKB/TrEMBL;Acc:B8JLY
Human Orthologue:
KCNIP2
Human Description:
Kv channel interacting protein 2 [Source:HGNC Symbol;Acc:15522]
Mouse Orthologue:
Kcnip2
Mouse Description:
Kv channel-interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:2135916]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39383 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110900 Essential Splice Site 72 271 4 10
ENSDART00000138639   None 207 None 9
Genomic Location (Zv9):
Chromosome 22 (position 37837488)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35022368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATTCACTGCTGTTTTTAAAGATCTGTATGATTACTTGAATCTTTTCA[T/A]CTCTCTTATAGACAGTATAGAGGAGGATTTTGAGCTTGCTACTGTGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link