si:ch211-153a8.2

Ensembl ID:
ENSDARG00000075842
ZFIN ID:
ZDB-GENE-090313-46
Human Orthologue:
PIGT
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class T [Source:HGNC Symbol;Acc:14938]
Mouse Orthologue:
Pigt
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class T Gene [Source:MGI Symbol;Acc:MGI:1926178]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10962 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113959 Nonsense 340 634 7 12
ENSDART00000143728 Nonsense 340 633 7 12
ENSDART00000145008   None 191 None 5
Genomic Location (Zv9):
Chromosome 23 (position 12506196)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12464998
KASP Assay ID:
2261-7416.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACGGACTCTGACAGAGGCATGTCCACTTGCTTCCTCTAGTAAAGTCTA[T/A]GTGGACATCACAGACAACCCTGAGGTGAATCAGAAACAATACAACACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link