si:dkey-1d7.3

Ensembl ID:
ENSDARG00000075837
ZFIN ID:
ZDB-GENE-091118-46
Human Orthologues:
TMEM132C, TMEM132D
Human Descriptions:
transmembrane protein 132C [Source:HGNC Symbol;Acc:25436]
transmembrane protein 132D [Source:HGNC Symbol;Acc:29411]
Mouse Orthologues:
Tmem132c, Tmem132d
Mouse Descriptions:
transmembrane protein 132C Gene [Source:MGI Symbol;Acc:MGI:2443061]
transmembrane protein 132D Gene [Source:MGI Symbol;Acc:MGI:3044963]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37274 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112859 Nonsense 799 1142 8 8
ENSDART00000139318 Nonsense 814 1157 9 9
Genomic Location (Zv9):
Chromosome 21 (position 17040871)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18407575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAGACAGCGACTCCAAATTGACCCTCACATCCCCTCTGAACATTCTT[C/T]AACACACCATTATGCAAGAAAGTACGACAAGTGGGATCAAATCGGCAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link