kiss1

Ensembl ID:
ENSDARG00000075829
ZFIN ID:
ZDB-GENE-080128-1
Description:
KiSS-1 metastasis-suppressor [Source:RefSeq peptide;Acc:NP_001106961]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35074 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111289 Nonsense 72 116 2 2
Genomic Location (Zv9):
Chromosome 11 (position 24246943)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23059540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCAGCGCTCTTCTCCATGGGTGCAGGTCCTCAGAAAAACACATGGTG[G/A]TGGTCTCCAGAAAGTCCTTACACCAAGAGGAGACAGAATGTAGCTTACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link