f7i

Ensembl ID:
ENSDARG00000075827
ZFIN IDs:
ZDB-GENE-021206-10, ZDB-GENE-021206-10, ZDB-GENE-021206-10
Description:
coagulation factor VIIi [Source:RefSeq peptide;Acc:NP_775335]
Human Orthologue:
F7
Human Description:
coagulation factor VII (serum prothrombin conversion accelerator) [Source:HGNC Symbol;Acc:3544]
Mouse Orthologue:
F7
Mouse Description:
coagulation factor VII Gene [Source:MGI Symbol;Acc:MGI:109325]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19389 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003463 Nonsense 62 443 2 8
ENSDART00000122230 Nonsense 62 443 2 8
ENSDART00000128600 Nonsense 63 445 2 9
Genomic Location:
Chromosome 1 (position 24931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGGCTGGAAACCTGGAGCGCGAGTGTGTGGAGGAGATCTGCGACTA[T/A]GAGGAGGCGCGCGAGGTGTTCGAGGACGACGACAGGACGGTACCACACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b6t9woo1