LOC559917

Ensembl ID:
ENSDARG00000075826
Human Orthologue:
MSH4
Human Description:
mutS homolog 4 (E. coli) [Source:HGNC Symbol;Acc:7327]
Mouse Orthologue:
Msh4
Mouse Description:
mutS homolog 4 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1860077]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8949 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111123 Nonsense 109 880 3 21
Genomic Location:
Chromosome 17 (position 43942092)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCRCGTGCGCCTGTRATCGTGGCTGTGGTGGAGGGACGAGGTTTAGCT[C/T]GAGGGGAGATTGGGATGGCCAGTATTAACATGAAATAYCCTGAGCTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ghzt8lw8