si:ch211-79l20.4

Ensembl ID:
ENSDARG00000075824
ZFIN ID:
ZDB-GENE-100922-238
Human Orthologue:
KIAA1429
Human Description:
KIAA1429 [Source:HGNC Symbol;Acc:24500]
Mouse Orthologue:
1110037F02Rik
Mouse Description:
RIKEN cDNA 1110037F02 gene Gene [Source:MGI Symbol;Acc:MGI:1913435]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22853 Nonsense Available for shipment Available now
sa17347 Nonsense Available for shipment Available now
sa36152 Nonsense Mutation detected in F1 DNA During 2017
sa6434 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113826 Nonsense 283 1835 8 23
ENSDART00000142215 Nonsense 284 1836 8 23
ENSDART00000142706   None 246 None 5
Genomic Location (Zv9):
Chromosome 16 (position 28941590)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26817364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACAAGTGTGTGATGTGTTATGTTTTCACCTTCAGGTGATGATGGATA[T/A]GAGCAGATATCCAGTGATGAGGAGGATTTAGAGAGTGGGGCTTTCAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113826 Nonsense 506 1835 8 23
ENSDART00000142215 Nonsense 507 1836 8 23
ENSDART00000142706   None 246 None 5
Genomic Location (Zv9):
Chromosome 16 (position 28942257)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26818031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACGTGCTGCGCTCCCTYGACAGCATCATCAGCGAGCCACAGGGCATC[G/T]ARGCTATGCTCAGAGACCGCCACCATCATGAKGATGATGGCACAAGCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113826 Nonsense 910 1835 11 23
ENSDART00000142215 Nonsense 911 1836 11 23
ENSDART00000142706   None 246 None 5
Genomic Location (Zv9):
Chromosome 16 (position 28947164)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26822938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAACATCTGACCTCAGTGATTTATATGTTTTTCAGAGCTCTCTAAGTG[G/A]TTGGAGCCACTTGAAAAATTACATTTCGATATCAGTGGCATTCCTATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113826 Essential Splice Site 965 1835 12 23
ENSDART00000142215 Essential Splice Site 966 1836 12 23
ENSDART00000142706   None 246 None 5
Genomic Location (Zv9):
Chromosome 16 (position 28947609)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26823383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCAGAGTTCTGTGCCACATTGCCTGCCCACCAGCAACWGTGCCAGG[T/C]ACATTYACACATATTACAMACCTTARTCNNNNNTAAACAGGACAAAAAAAAGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link