plxnb1a

Ensembl ID:
ENSDARG00000075821
ZFIN ID:
ZDB-GENE-050302-63
Description:
Plexin B1a [Source:UniProtKB/TrEMBL;Acc:B6E522]
Human Orthologue:
PLXNB1
Human Description:
plexin B1 [Source:HGNC Symbol;Acc:9103]
Mouse Orthologue:
Plxnb1
Mouse Description:
plexin B1 Gene [Source:MGI Symbol;Acc:MGI:2154238]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37627 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32425 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111518 Essential Splice Site 17 260 2 7
ENSDART00000131669   None 304 None 6
ENSDART00000137308   None 812 None 18
ENSDART00000142442   None 58 None 3
Genomic Location (Zv9):
Chromosome 23 (position 10092610)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10050751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGATTATGATTTTTTGGGGCAATAAATGTTTGTGTATGTGTCTTTCAA[G/A]GACAAAGAATTTGACTACCAGTGTGTGTTGGTGATCGAGGGCCGATCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111518 Nonsense 205 260 6 7
ENSDART00000131669   None 304 None 6
ENSDART00000137308   None 812 None 18
ENSDART00000142442   None 58 None 3
Genomic Location (Zv9):
Chromosome 23 (position 10083064)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10041205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTATGTGTGCCGTCAGTATTGTGTGTGAGACTGCAGCTAGTGTC[G/T]GAGAACAGAGCGGCCACGTCTCAGTGCAGGTCAGAGGAGGAGGAATCGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link