si:ch211-158b22.1-2

Ensembl ID:
ENSDARG00000075817
ZFIN ID:
ZDB-GENE-070424-138
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WUQ9]
Human Orthologue:
C6orf186
Human Description:
chromosome 6 open reading frame 186 [Source:HGNC Symbol;Acc:21566]
Mouse Orthologue:
9030224M15Rik
Mouse Description:
RIKEN cDNA 9030224M15 gene Gene [Source:MGI Symbol;Acc:MGI:3045338]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12178 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110678 Nonsense 217 300 4 5
ENSDART00000135091 Nonsense 217 227 5 5

The following transcripts of ENSDARG00000075817 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 53764611)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53609390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATCCTGCCGTCCCCCCACACAGAGCGCACAGCAACAGCAGGAAGCTC[A/T]AGAACATCCTCAACCACTTCGGCYACAGACAGGTCAGCAGCACTGGAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link