LOC572215

Ensembl ID:
ENSDARG00000075815
Human Orthologue:
SLC12A5
Human Description:
solute carrier family 12 (potassium/chloride transporter), member 5 [Source:HGNC Symbol;Acc:13818]
Mouse Orthologue:
Slc12a5
Mouse Description:
solute carrier family 12, member 5 Gene [Source:MGI Symbol;Acc:MGI:1862037]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20830 Essential Splice Site Available for shipment Available now
sa13981 Nonsense Available for shipment Available now
sa31545 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057258 Essential Splice Site 369 1071 8 25
Genomic Location (Zv9):
Chromosome 6 (position 55368463)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55474548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTCCTTCTTTACCATGTTAGTGGGCATCTACTTCCCTTCAGTGACAG[G/A]TTAGTCACTTCCTCACAATGTGATCTCATTCAGCATTCATGACTGGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057258 Nonsense 587 1071 14 25
Genomic Location (Zv9):
Chromosome 6 (position 55354400)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55460485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCTGGTACTACGCCATTGTTGCAATGGGCATCGCCGGCTGCATCTAC[A/T]AGTATATCGAGTTTCGAGGGTAAGTGGATTGTGACCCAGAGTCGAGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057258 Nonsense 1018 1071 24 25
Genomic Location (Zv9):
Chromosome 6 (position 55334582)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55440667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGAGGCGCATGCACACCGCACTTAGACTCAATGAAGTCATTATTAAG[A/T]AATCCCAGGAGGCCAAACTAGTGCTGCTGAACATGCCGGGACCACCCCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link