LOC572215

Ensembl ID:
ENSDARG00000075815
Human Orthologue:
SLC12A5
Human Description:
solute carrier family 12 (potassium/chloride transporter), member 5 [Source:HGNC Symbol;Acc:13818]
Mouse Orthologue:
Slc12a5
Mouse Description:
solute carrier family 12, member 5 Gene [Source:MGI Symbol;Acc:MGI:1862037]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20830 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13981 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057258 Essential Splice Site 369 1071 8 25
Genomic Location:
Chromosome 6 (position 55368463)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTCCTTCTTTACCATGTTAGTGGGCATCTACTTCCCTTCAGTGACAG[G/A]TTAGTCACTTCCTCACAATGTGATCTCATTCAGCATTCATGACTGGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057258 Nonsense 587 1071 14 25
Genomic Location:
Chromosome 6 (position 55354400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCTGGTACTACGCCATTGTTGCAATGGGCATCGCCGGCTGCATCTAC[A/T]AGTATATCGAGTTTCGAGGGTAAGTGGATTGTGACCCAGAGTCGAGGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f7vpswym