LOC568327

Ensembl ID:
ENSDARG00000075812
Human Orthologue:
KCNT2
Human Description:
potassium channel, subfamily T, member 2 [Source:HGNC Symbol;Acc:18866]
Mouse Orthologue:
Kcnt2
Mouse Description:
potassium channel, subfamily T, member 2 Gene [Source:MGI Symbol;Acc:MGI:3036273]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32858 Nonsense Mutation detected in F1 DNA During 2016
sa16058 Nonsense Available for shipment Available now
sa9113 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110337 Nonsense 9 898 1 21
Genomic Location (Zv9):
Chromosome 2 (position 11853408)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12278504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGCATTTGTTTCTAACTCTCCAGCATTTGTGGTGTTGAGCACTTGCAG[C/T]GAGCCGGAACAAAACTCACAGTTTTTGACTCTTTCTACTTCTGCATCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110337 Nonsense 538 898 12 21
Genomic Location (Zv9):
Chromosome 2 (position 11831315)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12256411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACAGCCTGTACAACTTCATCCTCCCATTACGAGCCTCGTAYAGACCA[C/T]AGAATGAACTGYGGCCCATTGTGCTGCTCTTGGAGYATGTGTAAACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110337 Nonsense 797 898 19 21
Genomic Location (Zv9):
Chromosome 2 (position 11819091)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12244187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTAGATGAGCAACATCAGARTCTTCAATGYGAAATACCAGACAGTCAAT[T/A]GCAGACACAGTCTCTGCGTCGGAGAAGCATGCAGTGGGCTTCCAGTCTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link