kirrel3a

Ensembl ID:
ENSDARG00000075806
ZFIN ID:
ZDB-GENE-091117-44
Human Orthologue:
KIRREL3
Human Description:
kin of IRRE like 3 (Drosophila) [Source:HGNC Symbol;Acc:23204]
Mouse Orthologue:
Kirrel3
Mouse Description:
kin of IRRE like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1914953]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34970 Nonsense Mutation detected in F1 DNA During 2017
sa38811 Essential Splice Site Mutation detected in F1 DNA During 2017
sa4391 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa34970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113414 Nonsense 110 774 3 16
ENSDART00000135756 Nonsense 110 564 3 13

The following transcripts of ENSDARG00000075806 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 41056347)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39770973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATGACGGAAGCTTTGAGTGTCAAGCCATCCAGGTTGCTGGCAGATCT[C/T]GACCCGCTCAACTCACTGTGCTAGGTCAGTGTAATCTTCAAGAAAAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113414 Essential Splice Site 554 774 13 16
ENSDART00000135756   None 564 None 13

The following transcripts of ENSDARG00000075806 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 41172408)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39887034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCCTCTCTTCTAGACAGAGAGAGATATCCGGCACAGTAAAAAGCGAAA[G/T]TAAGCTCGTCTCACTTCTTGCACACTTCCCTTTAAAAATCATACATCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4391
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113414 Nonsense 634 774 16 16
ENSDART00000135756   None 564 None 13

The following transcripts of ENSDARG00000075806 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 41201788)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39916414
KASP Assay ID:
554-3565.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCTTGTAGGATCCAACCAACGGCTATTACAGCRTGAACACCTTTAAA[G/T]AACAGCCAACCCCGACCATTTCTYTYACAGCCAATCAGAACGCTGAGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link