LOC564832

Ensembl ID:
ENSDARG00000075802
Human Orthologue:
GRIN3A
Human Description:
glutamate receptor, ionotropic, N-methyl-D-aspartate 3A [Source:HGNC Symbol;Acc:16767]
Mouse Orthologue:
Grin3a
Mouse Description:
glutamate receptor ionotropic, NMDA3A Gene [Source:MGI Symbol;Acc:MGI:1933206]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21642 Nonsense Available for shipment Available now
sa10612 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109916 Nonsense 149 1114 1 10
Genomic Location:
Chromosome 10 (position 4512030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTACTCGCTTCAGAGAGCCTCAATCGAGTGGCGGGGCTTTTACCTTA[C/A]AACCTCACGCTCGAGATTGTCATGGCTGTGGAAGCAGGGCTTGGAGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109916 Essential Splice Site 1004 1114 9 10
Genomic Location:
Chromosome 10 (position 4543224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCRACATTCAAAGAAGACAAATTGCAGACAGTTGCAAAACCGGAGAAAAG[G/A]TAAACCRCTTTCATATCAAAATACATTCAGGCAACCCTGAATTAMTGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fqkofsjb