LOC564832

Ensembl ID:
ENSDARG00000075802
Human Orthologue:
GRIN3A
Human Description:
glutamate receptor, ionotropic, N-methyl-D-aspartate 3A [Source:HGNC Symbol;Acc:16767]
Mouse Orthologue:
Grin3a
Mouse Description:
glutamate receptor ionotropic, NMDA3A Gene [Source:MGI Symbol;Acc:MGI:1933206]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21642 Nonsense Available for shipment Available now
sa30931 Splice Site, Nonsense Mutation detected in F1 DNA During 2015
sa10612 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109916 Nonsense 149 1114 1 10
Genomic Location:
Chromosome 10 (position 4512030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTACTCGCTTCAGAGAGCCTCAATCGAGTGGCGGGGCTTTTACCTTA[C/A]AACCTCACGCTCGAGATTGTCATGGCTGTGGAAGCAGGGCTTGGAGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109916 Splice Site, Nonsense 440 1114 2 10
Genomic Location:
Chromosome 10 (position 4528009)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGGCAAGGCTTGAGGCTAAAAATCTCACATCAGGAACCTTCCTGTCC[A/T]GGTAAATTATTTGATTCACTGTTTGATGCTTTGTAAGGTTTGTGTTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109916 Essential Splice Site 1004 1114 9 10
Genomic Location:
Chromosome 10 (position 4543224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCRACATTCAAAGAAGACAAATTGCAGACAGTTGCAAAACCGGAGAAAAG[G/A]TAAACCRCTTTCATATCAAAATACATTCAGGCAACCCTGAATTAMTGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fqkofsjb