si:ch211-15l13.1

Ensembl ID:
ENSDARG00000075792
ZFIN ID:
ZDB-GENE-041210-343
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5PNQ8]
Human Orthologue:
IQSEC3
Human Description:
IQ motif and Sec7 domain 3 [Source:HGNC Symbol;Acc:29193]
Mouse Orthologue:
Iqsec3
Mouse Description:
IQ motif and Sec7 domain 3 Gene [Source:MGI Symbol;Acc:MGI:2677208]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31400 Essential Splice Site Available for shipment Available now
sa30852 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6950 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113971 Essential Splice Site 1029 1143 10 14
ENSDART00000138846   None 602 None 6
Genomic Location (Zv9):
Chromosome 4 (position 26007388)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26714008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGACCATGGGACTGCTGGGCATGCAGTTCCACCTGTTTGAGAACGAAT[G/A]TAAGTTCCAACAGTTTTTTTATAGAATTATTTTTGAGTTTTTCTATCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113971 Essential Splice Site 1083 1143 11 14
ENSDART00000138846   None 602 None 6
Genomic Location (Zv9):
Chromosome 4 (position 26039822)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26746442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGAATCAATTGCTGAAGTGTCAGAGATGGAACAGATAAGAATTGAAT[G/A]TGAGTGGACTTTCAATTTCAGTTCAGTTCAATTCACATTTATTTGCATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113971 Nonsense 1139 1143 14 14
ENSDART00000138846   None 602 None 6
Genomic Location (Zv9):
Chromosome 4 (position 26066067)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26772687
KASP Assay ID:
554-4762.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTAGGTGTCAATTCACAACAGGCTTCAGACGTTCCAGCTCAATGCTG[C/A]ACCGCTGAGCCCTGAGAATGCTGCCCATCTCAACCACCAGAGGGAGCCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link