si:ch73-190m4.1

Ensembl ID:
ENSDARG00000075785
ZFIN ID:
ZDB-GENE-090311-56
Description:
Novel protein similar to vertebrate hect domain and RLD 3 (HERC3) [Source:UniProtKB/TrEMBL;Acc:B8JLD
Human Orthologues:
HERC5, HERC6
Human Descriptions:
hect domain and RLD 5 [Source:HGNC Symbol;Acc:24368]
hect domain and RLD 6 [Source:HGNC Symbol;Acc:26072]
Mouse Orthologue:
Herc6
Mouse Description:
hect domain and RLD 6 Gene [Source:MGI Symbol;Acc:MGI:1914388]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19588 Nonsense Available for shipment Available now
sa482 Essential Splice Site Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa19588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111114 Nonsense 332 992 8 24
ENSDART00000131544 Nonsense 332 350 8 8
ENSDART00000140883   None 408 None 10
Genomic Location (Zv9):
Chromosome 1 (position 51128099)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49977190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTAAACTAACTAAATGCTTCTCACACACAGAATATAATGACGAATA[T/A]ACAATTCAAAAACTTGTCGCGGGGGAGAATCATTCGTTTGCCTTGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa482
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111114 Essential Splice Site 726 992 18 24
ENSDART00000131544   None 350 None 8
ENSDART00000140883 Essential Splice Site 142 408 4 10
Genomic Location (Zv9):
Chromosome 1 (position 51135372)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49984463
KASP Assay ID:
554-0333.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCTTCATGTATAACGACAACGAAACTATGATCTGGTTCCCCGCGAAG[G/T]TAAGGCAAAGACTTTTTTTATTATGTTAAAGGTTTATTTGTGATTGTTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link