si:ch73-190m4.1

Ensembl ID:
ENSDARG00000075785
ZFIN ID:
ZDB-GENE-090311-56
Description:
Novel protein similar to vertebrate hect domain and RLD 3 (HERC3) [Source:UniProtKB/TrEMBL;Acc:B8JLD
Human Orthologues:
HERC5, HERC6
Human Descriptions:
hect domain and RLD 5 [Source:HGNC Symbol;Acc:24368]
hect domain and RLD 6 [Source:HGNC Symbol;Acc:26072]
Mouse Orthologue:
Herc6
Mouse Description:
hect domain and RLD 6 Gene [Source:MGI Symbol;Acc:MGI:1914388]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19588 Nonsense Available for shipment Available now
sa44513 Nonsense Mutation detected in F1 DNA During 2017
sa482 Essential Splice Site Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa19588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111114 Nonsense 332 992 8 24
ENSDART00000131544 Nonsense 332 350 8 8
ENSDART00000140883   None 408 None 10
Genomic Location (Zv9):
Chromosome 1 (position 51128099)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49977190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTAAACTAACTAAATGCTTCTCACACACAGAATATAATGACGAATA[T/A]ACAATTCAAAAACTTGTCGCGGGGGAGAATCATTCGTTTGCCTTGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111114 Nonsense 714 992 18 24
ENSDART00000131544   None 350 None 8
ENSDART00000140883 Nonsense 130 408 4 10
Genomic Location (Zv9):
Chromosome 1 (position 51135335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAACGTGTTTAAGGAGCTTTGTGATCCAGCTTCTCAGCTCTTCATGTA[T/A]AACGACAACGAAACTATGATCTGGTTCCCCGCGAAGGTAAGGCAAAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa482
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111114 Essential Splice Site 726 992 18 24
ENSDART00000131544   None 350 None 8
ENSDART00000140883 Essential Splice Site 142 408 4 10
Genomic Location (Zv9):
Chromosome 1 (position 51135372)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49984463
KASP Assay ID:
554-0333.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCTTCATGTATAACGACAACGAAACTATGATCTGGTTCCCCGCGAAG[G/T]TAAGGCAAAGACTTTTTTTATTATGTTAAAGGTTTATTTGTGATTGTTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link