PPP1R12C

Ensembl ID:
ENSDARG00000075779
Description:
protein phosphatase 1, regulatory (inhibitor) subunit 12C [Source:HGNC Symbol;Acc:14947]
Human Orthologue:
PPP1R12C
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 12C [Source:HGNC Symbol;Acc:14947]
Mouse Orthologue:
Ppp1r12c
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 12C Gene [Source:MGI Symbol;Acc:MGI:1924258]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24251 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24251
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112667 Essential Splice Site 46 142 2 5
Genomic Location (Zv9):
Chromosome 23 (position 6402083)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 6417298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGACATGCTAATTTAATGGGATAAACTGTAGTTTGTTTGTCTTTATCA[G/A]CTGTATGAGGATGCTCTGTCTGAGAATGAGAAGCTGAAGTCTCGACTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link