LOC797147

Ensembl ID:
ENSDARG00000075774
Human Orthologue:
FOXJ3
Human Description:
forkhead box J3 [Source:HGNC Symbol;Acc:29178]
Mouse Orthologue:
Foxj3
Mouse Description:
forkhead box J3 Gene [Source:MGI Symbol;Acc:MGI:2443432]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35095 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41847 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115037 Essential Splice Site 425 593 7 11
Genomic Location (Zv9):
Chromosome 11 (position 27175849)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26004674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGCACCAGAATCTCTCCCACCAGCAACAGATGCAGTGCAATACTGG[T/C]AAGAGTTCACCATTATGTCTACATTACAACACATTGTTTTTTCTAATACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115037 Essential Splice Site 458 593 8 11
Genomic Location (Zv9):
Chromosome 11 (position 27172556)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26001381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGCATCCAACTGCAACTGGTCTGATGTGGATTTGTCTCCCTTCCAAG[G/A]TTATAATTATTCATTTTGAACTAGGTCCACAGAACATAATAAGGGCCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link