sccpdha

Ensembl ID:
ENSDARG00000075766
ZFIN ID:
ZDB-GENE-040718-51
Description:
saccharopine dehydrogenase a [Source:RefSeq peptide;Acc:NP_001002359]
Human Orthologue:
SCCPDH
Human Description:
saccharopine dehydrogenase (putative) [Source:HGNC Symbol;Acc:24275]
Mouse Orthologue:
Sccpdh
Mouse Description:
saccharopine dehydrogenase (putative) Gene [Source:MGI Symbol;Acc:MGI:1924486]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14451 Essential Splice Site Available for shipment Available now
sa23013 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046802 Essential Splice Site 66 427 1 12
ENSDART00000114668 Essential Splice Site 66 466 1 13
Genomic Location (Zv9):
Chromosome 17 (position 12023200)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12005722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCAAACCCAAACTGGAGAAAGTTATCGAGCAAGCCGCTGCAAATCTCG[G/A]TGAGWGAAGAAGACAACWCCAAATTRTGTACACTTTAAATAAGTGAGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046802 Essential Splice Site 104 427 2 12
ENSDART00000114668 Essential Splice Site 104 466 2 13
Genomic Location (Zv9):
Chromosome 17 (position 12028669)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11989347
GRCz10 17 12011191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGCCATGTGCAAACAGGCTGTCATTGTGCTCAGCTGTGTTGGGCCTG[T/A]AAGTACCATCCTCAATCGCTTATTATGTGTGTGGGGGCAGCCTTTTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link