grik5

Ensembl ID:
ENSDARG00000075764
ZFIN ID:
ZDB-GENE-070821-6
Description:
Grik5 protein [Source:UniProtKB/TrEMBL;Acc:A9JSU7]
Human Orthologue:
GRIK5
Human Description:
glutamate receptor, ionotropic, kainate 5 [Source:HGNC Symbol;Acc:4583]
Mouse Orthologue:
Grik5
Mouse Description:
glutamate receptor, ionotropic, kainate 5 (gamma 2) Gene [Source:MGI Symbol;Acc:MGI:95818]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6415 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114766   None 716 None 17
ENSDART00000122055   None 716 None 16
ENSDART00000137390 Nonsense 773 1030 17 19
Genomic Location (Zv9):
Chromosome 16 (position 13296500)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11655591
KASP Assay ID:
554-5353.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTGCAGTTGCAGGAGAATAACAGGTTGGAGATCCTGAAGAGAAGATR[G/A]TGGGAGGGAGGAAAGTGTCCCAAAGAGGAAGACCACCGAGCCAAAGGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link