cfh

Ensembl ID:
ENSDARG00000075761
ZFIN ID:
ZDB-GENE-050208-661
Description:
Novel protein containing multiple sushi domains (SCR repeat) [Source:UniProtKB/TrEMBL;Acc:A8E7E2]
Human Orthologues:
CFH, CFHR1, CFHR2, CFHR3, CFHR4, CFHR5
Human Descriptions:
complement factor H [Source:HGNC Symbol;Acc:4883]
complement factor H-related 1 [Source:HGNC Symbol;Acc:4888]
complement factor H-related 2 [Source:HGNC Symbol;Acc:4890]
complement factor H-related 3 [Source:HGNC Symbol;Acc:16980]
complement factor H-related 4 [Source:HGNC Symbol;Acc:16979]
complement factor H-related 5 [Source:HGNC Symbol;Acc:24668]
Mouse Orthologues:
AL837518.1, Cfh, Cfhr1, Cfhr2, Gm4788
Mouse Descriptions:
complement component factor h Gene [Source:MGI Symbol;Acc:MGI:88385]
complement factor H-related 1 Gene [Source:MGI Symbol;Acc:MGI:2138169]
complement factor H-related 2 Gene [Source:MGI Symbol;Acc:MGI:3611575]
predicted gene 4788 Gene [Source:MGI Symbol;Acc:MGI:3646434]
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8BMW5]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29783 Nonsense Mutation detected in F1 DNA During 2015
sa7495 Missense Mutation detected in F1 DNA During 2015
sa29784 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa29783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079311   None 308 None 8
ENSDART00000105633 Nonsense 66 1005 2 20
ENSDART00000133313 Nonsense 105 837 3 16
Genomic Location:
Chromosome 22 (position 24231524)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAGCAAACGCTGATTTTAAACTTTTAGATGGGACGGAGTTTGTATTT[G/T]GAACAACGGTGGTGTATACTTGCAAGAAAGGGTAAACTTGTTTCATGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079311   None 308 None 8
ENSDART00000105633 Missense 101 1005 3 20
ENSDART00000133313 Missense 140 837 4 16
Genomic Location:
Chromosome 22 (position 24231729)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGCGTMCCTGCCGATCTCAAGGATGGGATAATGCCATCCCTGAGTGT[G/A]AAGGTATGCTTTTTTTTNCACTWTTTYCTTTTGTTTTCTSATAAACGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29784
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079311   None 308 None 8
ENSDART00000105633 Essential Splice Site 162 1005 4 20
ENSDART00000133313 Essential Splice Site 201 837 5 16
Genomic Location:
Chromosome 22 (position 24232023)
KASP Assay ID:
2261-6843.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTGCACAGAGAAGGGCGACTGGAGTGCCCCGGTTCCAAACTGCATAG[G/A]TTCGTTCAATTGTGCTTTATTTGATTTGTTTTTTTTTTTCTGAAATCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cw8vu9tj