cfh

Ensembl ID:
ENSDARG00000075761
ZFIN ID:
ZDB-GENE-050208-661
Description:
Novel protein containing multiple sushi domains (SCR repeat) [Source:UniProtKB/TrEMBL;Acc:A8E7E2]
Human Orthologues:
CFH, CFHR1, CFHR2, CFHR3, CFHR4, CFHR5
Human Descriptions:
complement factor H [Source:HGNC Symbol;Acc:4883]
complement factor H-related 1 [Source:HGNC Symbol;Acc:4888]
complement factor H-related 2 [Source:HGNC Symbol;Acc:4890]
complement factor H-related 3 [Source:HGNC Symbol;Acc:16980]
complement factor H-related 4 [Source:HGNC Symbol;Acc:16979]
complement factor H-related 5 [Source:HGNC Symbol;Acc:24668]
Mouse Orthologues:
AL837518.1, Cfh, Cfhr1, Cfhr2, Gm4788
Mouse Descriptions:
complement component factor h Gene [Source:MGI Symbol;Acc:MGI:88385]
complement factor H-related 1 Gene [Source:MGI Symbol;Acc:MGI:2138169]
complement factor H-related 2 Gene [Source:MGI Symbol;Acc:MGI:3611575]
predicted gene 4788 Gene [Source:MGI Symbol;Acc:MGI:3646434]
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8BMW5]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7495 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079311 None None 308 None 8
ENSDART00000105633 Missense 101 1005 3 20
ENSDART00000133313 Missense 140 837 4 16
Genomic Location:
Chromosome 22 (position 24231729)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGCGTMCCTGCCGATCTCAAGGATGGGATAATGCCATCCCTGAGTGT[G/A]AAGGTATGCTTTTTTTTNCACTWTTTYCTTTTGTTTTCTSATAAACGACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cw8vu9tj