LOC100149858

Ensembl ID:
ENSDARG00000075759
Human Orthologue:
SAMD4A
Human Description:
sterile alpha motif domain containing 4A [Source:HGNC Symbol;Acc:23023]
Mouse Orthologue:
Samd4
Mouse Description:
sterile alpha motif domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1921730]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31011 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108999 Nonsense 582 685 9 12
Genomic Location (Zv9):
Chromosome 17 (position 14939965)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15090793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGGCAGTATCAGATGCGGAGTCTGCCCGGTATACGACCTGTCCCTTTG[G/T]GAAGCACCGGCCTGTTCGGACCAACCCCACGGAGCAGCAGCAGCACCCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link