myo18l2

Ensembl ID:
ENSDARG00000075752
ZFIN ID:
ZDB-GENE-080425-5
Human Orthologue:
MYO18A
Human Description:
myosin XVIIIA [Source:HGNC Symbol;Acc:31104]
Mouse Orthologue:
Myo18a
Mouse Description:
myosin XVIIIA Gene [Source:MGI Symbol;Acc:MGI:2667185]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14885 Nonsense Available for shipment Available now
sa21785 Essential Splice Site, Missense Available for shipment Available now
sa16330 Essential Splice Site Available for shipment Available now
sa4385 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa12353 Nonsense Available for shipment Available now
sa13591 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110835 Nonsense 52 2454 1 43
ENSDART00000132023 Nonsense 41 1848 1 39
ENSDART00000145855 None None 239 None 6
Genomic Location:
Chromosome 10 (position 38405850)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGAGTCTGGAGGAAATGAGCGTGAGGAGAGGTTTCTTTCATCTTCAT[C/T]GAAGCAACTCTAAACGGGAGACGAAAGGGAAGCTGGAGATTTCCAGTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110835 Missense 330 2454 2 43
ENSDART00000132023 Essential Splice Site 318 1848 None 39
ENSDART00000145855 None None 239 None 6
Genomic Location:
Chromosome 10 (position 38403179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAACTGAGCCGCTGCTGGCTGAGGAACACCAAAGGCCCATATCGCGAGG[T/C]CTATGAGGTGAGATGCAAGTTTGTGTCATGGTTGTGATGTGTTTAACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110835 Essential Splice Site 332 2454 2 43
ENSDART00000132023 None None 1848 None 39
ENSDART00000145855 None None 239 None 6
Genomic Location:
Chromosome 10 (position 38403171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGCTGCTGGCTGAGRMACACCAAAGRCCCATATCGYGAGGTCTATGAG[G/A]TGAGATGCAAGTTTGTGTCATGGTTGTGATGTGTTTAACTAACCAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110835 Essential Splice Site 1025 2454 None 43
ENSDART00000132023 Missense 993 1848 17 39
ENSDART00000145855 None None 239 None 6
Genomic Location:
Chromosome 10 (position 38344709)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGGCGGTCAAAAAGAAGTCTCTTTGCCTTCAGATTAAACTCCAAGTGG[T/C]GGGTTTTCNAAGAGTCCCAGGCTGAATACTCTAACAACTTCTGGGTTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110835 Nonsense 1029 2454 19 43
ENSDART00000132023 None None 1848 None 39
ENSDART00000145855 None None 239 None 6
Genomic Location:
Chromosome 10 (position 38343210)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCTTATGCTAATTTATAAATTTGGTCCTTTCAATCAGGAWGCACTGY[T/A]GGACACCATCCGCAGATCCAAAGTTCACTTTGTCCACTGTCTGTTACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110835 Nonsense 1731 2454 35 43
ENSDART00000132023 Nonsense 1569 1848 32 39
ENSDART00000145855 None None 239 None 6
Genomic Location:
Chromosome 10 (position 38304710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCTCMGTCGTCTGCAGAGAGAGAAGAATGACCTGCAGTCTCGCTTC[G/T]AGGAGGATCAGGAGGACATGAACGAACTCATGAAGAAACACAAAGCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3jmsilfo