OVGP1 (4 of 4)

Ensembl ID:
ENSDARG00000075745
Description:
oviductal glycoprotein 1, 120kDa [Source:HGNC Symbol;Acc:8524]
Human Orthologue:
OVGP1
Human Description:
oviductal glycoprotein 1, 120kDa [Source:HGNC Symbol;Acc:8524]
Mouse Orthologue:
Ovgp1
Mouse Description:
oviductal glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:106661]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21904 Nonsense Mutation detected in F1 DNA During 2014
sa14389 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111829 Nonsense 31 354 1 9
Genomic Location:
Chromosome 11 (position 25029704)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGCAAGATACCTTCCTGAAAATGTGGACCCTAACTTGTGTACTCATT[T/A]AATTTATGCTTTTGCTATTATCAACTATGCCAATAACATTGCAGGCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111829 Essential Splice Site 219 354 6 9
Genomic Location:
Chromosome 11 (position 25027613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTTTGTACAGTGCCATGAGTGATGACAAGGATATCAAATCAAACACTG[T/A]AAGCAAGAGCACKCTTATATAAGAGCAACCCTCAAGCAAAKACCTTATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lhkxfl1t