LOC100333116

Ensembl ID:
ENSDARG00000075743
Human Orthologue:
MRPL47
Human Description:
mitochondrial ribosomal protein L47 [Source:HGNC Symbol;Acc:16652]
Mouse Orthologue:
Mrpl47
Mouse Description:
mitochondrial ribosomal protein L47 Gene [Source:MGI Symbol;Acc:MGI:1921850]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17345 Nonsense Available for shipment Available now
sa10686 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115031 Nonsense 48 249 2 7
Genomic Location:
Chromosome 6 (position 29116076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATATNNGTTTTCATGTTTTTGGSAATTTAGACAAGTGGCTGACTCGTG[G/A]TGGTWCAGAAGTTCTTTGAATAGCCGATCTCTCCACACAACGTGTGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115031 Essential Splice Site 106 249 3 7
Genomic Location:
Chromosome 6 (position 29115745)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ASTGCAAAACAGCTAAGGGTGAAAAGWAACGAAGATTTGCATAAACTTTG[G/T]TAAYTGAGTAGGATTTTTACAGTCTGAMGACTTAANNNNACAACAGTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e6d591m5