taf4b

Ensembl ID:
ENSDARG00000075732
ZFIN ID:
ZDB-GENE-070424-105
Description:
Novel protein similar to vertebrate TAF4 RNA polymerase II, TATA box binding protein (TBP)-associate
Human Orthologue:
TAF4B
Human Description:
TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa [Source:HGNC Symbo
Mouse Orthologue:
Taf4b
Mouse Description:
TAF4B RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Ac

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14657 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057039 Nonsense 829 833 15 15
Genomic Location:
Chromosome 20 (position 18341940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCTACATGGAGCAAGACCCCACATTCAGACACACTCTCGTGCTCTAC[A/T]GAGCCTTTCTAGGTTAGATCACCACACAGCTTKAAGGTATGAGCCTTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d9mcq1vc