si:ch211-117c8.4

Ensembl ID:
ENSDARG00000075730
ZFIN ID:
ZDB-GENE-081107-5
Description:
Deoxyribonucleoside 5'-monophosphate N-glycosidase [Source:UniProtKB/Swiss-Prot;Acc:B8A556]
Human Orthologue:
C6orf108
Human Description:
chromosome 6 open reading frame 108 [Source:HGNC Symbol;Acc:21218]
Mouse Orthologue:
BC048355
Mouse Description:
cDNA sequence BC048355 Gene [Source:MGI Symbol;Acc:MGI:3039376]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42125 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113060 Nonsense 14 143 1 4
ENSDART00000138892 Nonsense 14 53 1 4
Genomic Location (Zv9):
Chromosome 13 (position 3878413)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4095333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCAAATTATGAACATATACTTTTGCGGAAGCATTCGGGGAGGGCGA[C/T]AGGACGTGGTTATTTATCAGACAATAGTGAAGAAGTTGCAGCAGTATGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link