LOC565873

Ensembl ID:
ENSDARG00000075725
Human Orthologue:
CEP152
Human Description:
centrosomal protein 152kDa [Source:HGNC Symbol;Acc:29298]
Mouse Orthologue:
Cep152
Mouse Description:
centrosomal protein 152 Gene [Source:MGI Symbol;Acc:MGI:2139083]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38112 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24712 Nonsense Mutation detected in F1 DNA During 2016
sa13346 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114385 Essential Splice Site 901 1560 18 27
Genomic Location:
Chromosome 25 (position 33307177)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAAGGCTGAATGGGAGAGACTTCAACAGCAGCACGTCCAGGAACAGG[T/A]GATTCTTGTTTAGATTGCTGGAAACAGGGCTGGGTCTGGATTCAGAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114385 Nonsense 1306 1560 26 27
Genomic Location:
Chromosome 25 (position 33295775)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGACCCCGGTGGCCAAACGCAAGCATCCGAGAATGCAGAACGCTTA[T/A]GGTAAATAAAAATATCTGTGTTAAAGTGGCTGTAATATGCTGTTTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114385 Nonsense 1534 1560 27 27
Genomic Location:
Chromosome 25 (position 33294255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGAGAGCCGATCCCGGGATCAGAAGRACACGGTGTCCGGAAAATGTG[T/A]CCAAAGAGCTTGTTTTCCGAGTTGAAAGTGCAKCAGCAGGACAGCGGGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link