LOC565873

Ensembl ID:
ENSDARG00000075725
Human Orthologue:
CEP152
Human Description:
centrosomal protein 152kDa [Source:HGNC Symbol;Acc:29298]
Mouse Orthologue:
Cep152
Mouse Description:
centrosomal protein 152 Gene [Source:MGI Symbol;Acc:MGI:2139083]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24712 Nonsense Mutation detected in F1 DNA During 2014
sa13346 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114385 Nonsense 1306 1560 26 27
Genomic Location:
Chromosome 25 (position 33295775)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGACCCCGGTGGCCAAACGCAAGCATCCGAGAATGCAGAACGCTTA[T/A]GGTAAATAAAAATATCTGTGTTAAAGTGGCTGTAATATGCTGTTTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114385 Nonsense 1534 1560 27 27
Genomic Location:
Chromosome 25 (position 33294255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGAGAGCCGATCCCGGGATCAGAAGRACACGGTGTCCGGAAAATGTG[T/A]CCAAAGAGCTTGTTTTCCGAGTTGAAAGTGCAKCAGCAGGACAGCGGGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m5adrhpu