il2rb

Ensembl ID:
ENSDARG00000075720
ZFIN ID:
ZDB-GENE-080108-2
Description:
interleukin 2 receptor, beta [Source:RefSeq peptide;Acc:NP_001121739]
Human Orthologue:
IL2RB
Human Description:
interleukin 2 receptor, beta [Source:HGNC Symbol;Acc:6009]
Mouse Orthologue:
Il2rb
Mouse Description:
interleukin 2 receptor, beta chain Gene [Source:MGI Symbol;Acc:MGI:96550]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8784 Nonsense Mutation detected in F1 DNA During 2016
sa11245 Essential Splice Site Available for shipment Available now
sa31329 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8784
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112338 Nonsense 57 503 2 8
ENSDART00000122985 Nonsense 57 541 2 9
Genomic Location (Zv9):
Chromosome 3 (position 25300056)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25068241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGCGTRTGGTGGAACTATAGCAATTTCTCCAACCAGCAATGTGAGCTT[G/T]AGGTTAACTGTAAAATAAGGTTTGTGATTTTACTTCACTTCAAGTCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112338 Essential Splice Site 238 503 6 8
ENSDART00000122985 Essential Splice Site 276 541 7 9
Genomic Location (Zv9):
Chromosome 3 (position 25303710)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25071895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCATTATCATACCAATARTCATCTATAAAGTAAAGAAAAGCAGCCGG[T/C]GAGTATTRCATGTGTGTRTCTTGCCCTTGCNNNNTTTTTTTTAACAAAGTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112338 Nonsense 254 503 7 8
ENSDART00000122985 Nonsense 292 541 8 9
Genomic Location (Zv9):
Chromosome 3 (position 25304116)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25072301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGCCATTAAAACCAATACAACATGTTCCAGACCCATCCAAATACTTC[C/T]AGCCTCTTCATACCATTCATGGTGGAAACTTCCGGGTAAGTTCAAAATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link