il2rb

Ensembl ID:
ENSDARG00000075720
ZFIN ID:
ZDB-GENE-080108-2
Description:
interleukin 2 receptor, beta [Source:RefSeq peptide;Acc:NP_001121739]
Human Orthologue:
IL2RB
Human Description:
interleukin 2 receptor, beta [Source:HGNC Symbol;Acc:6009]
Mouse Orthologue:
Il2rb
Mouse Description:
interleukin 2 receptor, beta chain Gene [Source:MGI Symbol;Acc:MGI:96550]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8784 Nonsense Mutation detected in F1 DNA During 2014
sa5202 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa11245 Essential Splice Site Available for shipment Available now
sa3430 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8784
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112338 Nonsense 57 503 2 8
ENSDART00000122985 Nonsense 57 541 2 9
Genomic Location:
Chromosome 3 (position 25300056)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGCGTRTGGTGGAACTATAGCAATTTCTCCAACCAGCAATGTGAGCTT[G/T]AGGTTAACTGTAAAATAAGGTTTGTGATTTTACTTCACTTCAAGTCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112338 Essential Splice Site 63 503 3 8
ENSDART00000122985 Missense 101 541 4 9
Genomic Location:
Chromosome 3 (position 25300349)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTCCTTACATTTTACCTTTCTGTCACACAGTACTTCTTTTTCCTTA[G/T]CAAAATGGTATTGTCTGTGAGCTGTAATGGATCACTCATCAGCAGCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112338 Essential Splice Site 238 503 6 8
ENSDART00000122985 Essential Splice Site 276 541 7 9
Genomic Location:
Chromosome 3 (position 25303710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCATTATCATACCAATARTCATCTATAAAGTAAAGAAAAGCAGCCGG[T/C]GAGTATTRCATGTGTGTRTCTTGCCCTTGCNNNNTTTTTTTTAACAAAGTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112338 Nonsense 444 503 8 8
ENSDART00000122985 Nonsense 482 541 9 9
Genomic Location:
Chromosome 3 (position 25308260)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGGTTTCCTTCATTATGTCACTGTCTCAGGGTGGCGTTCAGCCGGCT[G/T]AGGKTTTCCCTCCAGTRCCTGTCTTCTCAGCCTGGTCTGAACTTGTAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4o0vg4lv