rpz5

Ensembl ID:
ENSDARG00000075718
ZFIN ID:
ZDB-GENE-030131-4678
Description:
rapunzel 5 [Source:RefSeq peptide;Acc:NP_001103594]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22941 Nonsense Mutation detected in F1 DNA During 2014
sa6448 Nonsense Mutation detected in F1 DNA During 2014
sa14760 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105931 Nonsense 81 393 2 2
ENSDART00000134734 Nonsense 81 201 3 3
Genomic Location:
Chromosome 16 (position 49559110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAATTTGAAAAGATCAACCAAAAACTGGAAGGGATTCAAGACGAAATC[G/T]AACAAATTGCTTTGGAGTTGCAGAGGACATCCATGAACAAGCAGAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105931 Nonsense 332 393 2 2
ENSDART00000134734 None None 201 None 3
Genomic Location:
Chromosome 16 (position 49559863)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTTTCAGCGCTGACCCGAAACCGATTAACAAGAGCGAGATTGTAGAT[C/T]AGATAGAGATGCAGAAGCTGAAGGGCAACATGCAGTCTGTGGCTCAGACS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105931 Nonsense 387 393 2 2
ENSDART00000134734 None None 201 None 3
Genomic Location:
Chromosome 16 (position 49560030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAACTTCCAGCCGGAGTRTTTCTAYTTCGCRAGGCACAAGAAGGCATA[C/A]CTKTGCATTCACTCTGAAYAGAWRTGCCAAACTTTRATATCAGTCTCCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nep4xwvm