shox2

Ensembl ID:
ENSDARG00000075713
ZFIN ID:
ZDB-GENE-040426-1457
Description:
short stature homeobox protein 2 [Source:RefSeq peptide;Acc:NP_957490]
Human Orthologue:
SHOX2
Human Description:
short stature homeobox 2 [Source:HGNC Symbol;Acc:10854]
Mouse Orthologue:
Shox2
Mouse Description:
short stature homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:1201673]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42468 Missense, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009564 Missense 182 299 4 5
ENSDART00000135460 Nonsense 58 191 2 3
ENSDART00000138941 Missense 116 200 5 6
Genomic Location (Zv9):
Chromosome 15 (position 2173120)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2220242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGACATCACTGTTTTTCAGGGGTTCTCATCGGAGCGGCGAGCCAGTT[T/A]GAAGCATGTCGCGTGGCTCCATATGTCAACGTGGGAGCTCTGCGCATGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link