CTBP2

Ensembl ID:
ENSDARG00000075712
Description:
C-terminal binding protein 2 [Source:HGNC Symbol;Acc:2495]
Human Orthologues:
AC011841.1, CTBP2
Human Descriptions:
C-terminal binding protein 2 pseudogene (MGC70870), non-coding RNA [Source:RefSeq DNA;Acc:NR_003682]
C-terminal binding protein 2 [Source:HGNC Symbol;Acc:2495]
Mouse Orthologue:
Ctbp2
Mouse Description:
C-terminal binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1201686]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15895 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103422 Essential Splice Site 603 754 17 29
Genomic Location (Zv9):
Chromosome 12 (position 50117385)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48680081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTTCCTCACAGCTCTGTCAGCGAGTGTTTGAGCTCAAAAGCMTCAA[G/A]TGAAAAGCAAATGTTAAACATCTTRAAGTGGGCGGGGCTTGTCAGATACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link