NID2 (1 of 2)

Ensembl ID:
ENSDARG00000075707
Description:
nidogen 2 (osteonidogen) [Source:HGNC Symbol;Acc:13389]
Human Orthologue:
NID2
Human Description:
nidogen 2 (osteonidogen) [Source:HGNC Symbol;Acc:13389]
Mouse Orthologue:
Nid2
Mouse Description:
nidogen 2 Gene [Source:MGI Symbol;Acc:MGI:1298229]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23022 Essential Splice Site Available for shipment Available now
sa25037 Nonsense Mutation detected in F1 DNA During 2017
sa15802 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115064 Essential Splice Site 169 1351 2 27
Genomic Location (Zv9):
Chromosome 17 (position 14713960)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14864788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTCAGCTTATGAAGAGGTCGCGCGCAGCTCTAGCCCATCCCATCGGG[T/A]AAGAAAACAGCTTTGAGGTCTTGTTTACACCTGTTGTTAAAGGGATAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115064 Nonsense 230 1351 3 27
Genomic Location (Zv9):
Chromosome 17 (position 14700817)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14851645
KASP Assay ID:
554-7876.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTCGTGTGGGATTTTCCAGAGGAGAGATTTCCTACTTGATTTTTTCT[C/T]GAACAGAAGGGCCGTATTATAGCCTCACCAGCAATGAGCAGTCCGTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15802
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115064 Nonsense 473 1351 9 27
Genomic Location (Zv9):
Chromosome 17 (position 14695305)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14846133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAWCCATTACYCGACAGATAAYAAAGAGACGTGTGAGCGTTTCCAGCAG[C/T]AGTGCAGTCTAAACGCTCACTGTAYAGATCATTCCACCGGCTTCTGCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link