ENSDARG00000075699

Ensembl ID:
ENSDARG00000075699
Human Orthologues:
TMEM132C, TMEM132D
Human Descriptions:
transmembrane protein 132C [Source:HGNC Symbol;Acc:25436]
transmembrane protein 132D [Source:HGNC Symbol;Acc:29411]
Mouse Orthologues:
Tmem132c, Tmem132d
Mouse Descriptions:
transmembrane protein 132C Gene [Source:MGI Symbol;Acc:MGI:2443061]
transmembrane protein 132D Gene [Source:MGI Symbol;Acc:MGI:3044963]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13680 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115328 Nonsense 388 667 3 7
Genomic Location:
Chromosome 21 (position 17516565)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGTCAAGACGTCAGGAGCGAGGGACAYCGAGTGGTCACTCTGCACTGC[C/T]GAAGGAAGGAAGCCAGCTTTGGAAAACGGTCAGTAGCTGTCTGTTCTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nfvta3ce