ENSDARG00000075699

Ensembl ID:
ENSDARG00000075699
Human Orthologues:
TMEM132C, TMEM132D
Human Descriptions:
transmembrane protein 132C [Source:HGNC Symbol;Acc:25436]
transmembrane protein 132D [Source:HGNC Symbol;Acc:29411]
Mouse Orthologues:
Tmem132c, Tmem132d
Mouse Descriptions:
transmembrane protein 132C Gene [Source:MGI Symbol;Acc:MGI:2443061]
transmembrane protein 132D Gene [Source:MGI Symbol;Acc:MGI:3044963]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43617 Nonsense Mutation detected in F1 DNA During 2016
sa43616 Nonsense Mutation detected in F1 DNA During 2016
sa13680 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115328 Nonsense 74 667 2 7
Genomic Location (Zv9):
Chromosome 21 (position 17575297)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18723549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGGTTTGGTCCCATTCCAACGTATCTTCCAGTGCGATACCAGGTAT[T/A]AAACGCAGAGTCTGCCTTCTTCTTAAAGGAGGCCAACCAGGACATCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115328 Nonsense 185 667 2 7
Genomic Location (Zv9):
Chromosome 21 (position 17574964)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18723216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTAGTTGGCCAAAGGTTCAGGTTCTCTTCTACGTTGTTGGCCGGGACT[G/A]GGATGACTATAGCGCTGTGGACAAGTTGCCGTGTGTCAGGATGTTTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115328 Nonsense 388 667 3 7
Genomic Location (Zv9):
Chromosome 21 (position 17516565)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18664817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGTCAAGACGTCAGGAGCGAGGGACAYCGAGTGGTCACTCTGCACTGC[C/T]GAAGGAAGGAAGCCAGCTTTGGAAAACGGTCAGTAGCTGTCTGTTCTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link