LOC561946

Ensembl ID:
ENSDARG00000075698
Human Orthologue:
NKPD1
Human Description:
NTPase, KAP family P-loop domain containing 1 [Source:HGNC Symbol;Acc:24739]
Mouse Orthologue:
Nkpd1
Mouse Description:
NTPase, KAP family P-loop domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916797]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7674 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111412 Nonsense 713 737 4 4
Genomic Location:
Chromosome 11 (position 34127259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAATGGATGACTTTTAAATTTCATTTCCTTGGGGTCACACCTTCTAGT[C/T]GACCKGCTCAACCACAAAGKCATCTAGCCGCCACAAACCCTGGAGTGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k83yy4n4