si:ch211-160m22.1

Ensembl ID:
ENSDARG00000075687
ZFIN ID:
ZDB-GENE-081107-12
Description:
Novel protein similar to H.sapiens ANAPC1, anaphase promoting complex subunit 1 (ANAPC1) [Source:Uni
Human Orthologue:
ANAPC1
Human Description:
anaphase promoting complex subunit 1 [Source:HGNC Symbol;Acc:19988]
Mouse Orthologue:
Anapc1
Mouse Description:
anaphase promoting complex subunit 1 Gene [Source:MGI Symbol;Acc:MGI:103097]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38973 Nonsense Mutation detected in F1 DNA During 2017
sa2701 Nonsense F2 line generated During 2017
sa5608 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa38973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109247 Nonsense 245 1932 7 47
ENSDART00000133146 Nonsense 245 500 8 13
ENSDART00000140045   None 1336 None 33

The following transcripts of ENSDARG00000075687 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 47488724)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46740729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCGGCTCCAGTATGTTTCAGACAGCGCTCTGAGAGTGGTGTTCACCTG[C/A]CTCAAACCCTCCATTATCATGACCTACGACACACAGCAGTGCACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2701
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109247 Nonsense 977 1932 24 47
ENSDART00000133146   None 500 None 13
ENSDART00000140045 Nonsense 381 1336 10 33
ENSDART00000109247 Nonsense 977 1932 24 47
ENSDART00000133146   None 500 None 13
ENSDART00000140045 Nonsense 381 1336 10 33

The following transcripts of ENSDARG00000075687 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 47555698)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46807703
KASP Assay ID:
554-3051.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACCCCTGCTCTGATTGGTCCGAAGAGGTCTGCGCTCTGATTGGCCGA[C/T]AGGACCTGACCAGACAAGCKCACAAAGTCACTCTAGCCAATCGTAAATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5608
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109247 Nonsense 977 1932 24 47
ENSDART00000133146   None 500 None 13
ENSDART00000140045 Nonsense 381 1336 10 33
ENSDART00000109247 Nonsense 977 1932 24 47
ENSDART00000133146   None 500 None 13
ENSDART00000140045 Nonsense 381 1336 10 33

The following transcripts of ENSDARG00000075687 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 47555698)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46807703
KASP Assay ID:
554-3051.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACCCCTGCTCTGATTGGTCCGAAGAGGTCTGCGCTCTGATTGGCCGA[C/T]AGGACCTGACCAGACAAGCKCACAAAGTCACTCTAGCCAATCGTAAATCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link