LOC100332519

Ensembl ID:
ENSDARG00000075685
Human Orthologue:
FRMPD4
Human Description:
FERM and PDZ domain containing 4 [Source:HGNC Symbol;Acc:29007]
Mouse Orthologue:
Frmpd4
Mouse Description:
FERM and PDZ domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:3042378]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15687 Essential Splice Site Available for shipment Available now
sa21614 Nonsense Mutation detected in F1 DNA During 2014
sa12377 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112441 Essential Splice Site 14 1130 2 15
Genomic Location:
Chromosome 9 (position 56096482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KAAATGTTGCCTCAATTGATGTATTTTCCTCNNNNNNNTTTTTTTGTTTGTTTGTTT[T/A]GCAGTCASCTCTCGCAGTCCAGTTCTCTGGAGGAGGTGCGCGTTGATGYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112441 Nonsense 64 1130 2 15
Genomic Location:
Chromosome 9 (position 56096632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTGCTCGGCTTTGGCTTCGTGGCGGGCAGTGAGAAACCTGTCGTGGTT[C/T]GATCTGTTACTCCAGGTACACAAATAACTAGATCAGCTACATTTATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112441 Essential Splice Site 391 1130 11 15
Genomic Location:
Chromosome 9 (position 56121912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTGACCTGCGGCTGTATGGAGGACGAGTGTTCAAGTCTACACTGGTT[G/T]TAAGTGCANGAAAAAAACGGTGCACGACATTCACTACATACTGTATGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w0drc7tr