arhgap21b

Ensembl ID:
ENSDARG00000075673
ZFIN ID:
ZDB-GENE-030131-4944
Description:
Novel protein similar to human and mouse Rho GTPase activating protein 21 (ARHGAP21) [Source:UniProt
Human Orthologue:
ARHGAP21
Human Description:
Rho GTPase activating protein 21 [Source:HGNC Symbol;Acc:23725]
Mouse Orthologue:
Arhgap21
Mouse Description:
Rho GTPase activating protein 21 Gene [Source:MGI Symbol;Acc:MGI:1918685]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19692 Nonsense Mutation detected in F1 DNA During 2014
sa3410 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091298 Nonsense 449 1793 7 24
ENSDART00000134083 Nonsense 359 1703 4 21

The following transcripts of ENSDARG00000075673 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12171140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTAGTGTGTCCTCTGATGGTCTCATACGGAAGCCCCGTGCTCATTCAT[C/A]AGACTATGTGGAACATGGTGAACTAGTTTCTGCTGCACCATGGGCAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091298 Nonsense 1022 1793 15 24
ENSDART00000134083 Nonsense 932 1703 12 21

The following transcripts of ENSDARG00000075673 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 12186808)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATAAAGCTGCGTGGAGAAGAGGTATTCCAGGTTTAAAGAAAAAGCCA[C/T]AAGATAAGARGCCTGCTGCTGGCGTCACATTTGGAGTACGACTGGATAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bmjl4wmo