rereb

Ensembl ID:
ENSDARG00000075670
ZFIN ID:
ZDB-GENE-070212-3
Human Orthologue:
RERE
Human Description:
arginine-glutamic acid dipeptide (RE) repeats [Source:HGNC Symbol;Acc:9965]
Mouse Orthologue:
Rere
Mouse Description:
arginine glutamic acid dipeptide (RE) repeats Gene [Source:MGI Symbol;Acc:MGI:2683486]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12842 Essential Splice Site Available for shipment Available now
sa9169 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18848 Nonsense Available for shipment Available now
sa16445 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111639 Essential Splice Site 160 1216 6 17
Genomic Location:
Chromosome 6 (position 40607302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAACTTCTTCAAGATTCGTAAGGATCTACTGCCTAGTAAGAAAACGG[T/A]ATGGAAATCTGYYATTTCAAATCTATTCATAAATATKTGTCAATTTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111639 Essential Splice Site 243 1216 8 17
Genomic Location:
Chromosome 6 (position 40607793)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGAGCAGGGTGGCAAACGTCAAGCTTGCAGTCACTGTCTATCCACTAG[T/A]AAGTTTATTTTACTATTCTCCAGTGCTGGGTTTTRAGAATACTGTACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111639 Nonsense 569 1216 12 17
ENSDART00000111639 Nonsense 569 1216 12 17
Genomic Location:
Chromosome 6 (position 40612308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTGCAATGTCCAGGACAGGGGCAGTCATTGCCTGTGCCAGCCCATTA[T/G]CAGCACAATTCAGGTCAGCTACAAAATCCTTCATCTGGAGCCAATCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111639 Nonsense 569 1216 12 17
ENSDART00000111639 Nonsense 569 1216 12 17
Genomic Location:
Chromosome 6 (position 40612308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTGCAATGTCCAGGACAGGGGCAGTCATTGCCTGTGCCAGCCCATTA[T/G]CAGCACAATTCAGGTCAGCTACAAAATCCTTCATCTGGAGCCAATCAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o5ds72u0