A9ULT1_DANRE

Ensembl ID:
ENSDARG00000075664
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9ULT1]
Human Orthologue:
DHCR7
Human Description:
7-dehydrocholesterol reductase [Source:HGNC Symbol;Acc:2860]
Mouse Orthologue:
Dhcr7
Mouse Description:
7-dehydrocholesterol reductase Gene [Source:MGI Symbol;Acc:MGI:1298378]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2797 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2797
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109825 Nonsense 380 437 10 11
Genomic Location:
Chromosome 15 (position 46768594)
KASP Assay ID:
554-2782.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGTTCGACACCCTAACTATCTAGGAGACGTGATGATGATGTTGGCCTG[G/A]TGTCTGCCCTGCGGTACGTCWGTGTTTATCAGCAATCMCTGCAGCTGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/glvi08cr