A9ULT1_DANRE

Ensembl ID:
ENSDARG00000075664
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9ULT1]
Human Orthologue:
DHCR7
Human Description:
7-dehydrocholesterol reductase [Source:HGNC Symbol;Acc:2860]
Mouse Orthologue:
Dhcr7
Mouse Description:
7-dehydrocholesterol reductase Gene [Source:MGI Symbol;Acc:MGI:1298378]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32069 Nonsense Mutation detected in F1 DNA During 2016
sa36007 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2797 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa32069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109825 Nonsense 80 437 3 11
Genomic Location (Zv9):
Chromosome 15 (position 46765628)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47284776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCCTGGGTTCTGCTCAGCTCTGGATCCTCCATCTGGGACTGGTGGT[C/A]AGTGTGTGTGCTGCTGTCCTTTACTGTCCTGCAGGTGGCGCTCTATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109825 Essential Splice Site 220 437 6 11
Genomic Location (Zv9):
Chromosome 15 (position 46766333)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47284071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCGATGTCAAACACTTCGTGATGGTCAGGATTGGGTTCATTGGCTGG[G/A]TGAGTGTGTGTGTGAACGCTTCTTCTTCTCAATCAAGTGTGCAAATGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2797
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109825 Nonsense 380 437 10 11
Genomic Location (Zv9):
Chromosome 15 (position 46768594)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 47281810
KASP Assay ID:
554-2782.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGTTCGACACCCTAACTATCTAGGAGACGTGATGATGATGTTGGCCTG[G/A]TGTCTGCCCTGCGGTACGTCWGTGTTTATCAGCAATCMCTGCAGCTGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link