CCDC135

Ensembl ID:
ENSDARG00000075654
Description:
coiled-coil domain containing 135 [Source:HGNC Symbol;Acc:25289]
Human Orthologue:
CCDC135
Human Description:
coiled-coil domain containing 135 [Source:HGNC Symbol;Acc:25289]
Mouse Orthologue:
Ccdc135
Mouse Description:
coiled-coil domain containing 135 Gene [Source:MGI Symbol;Acc:MGI:2685616]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24597 Nonsense Available for shipment Available now
sa24596 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109207 Nonsense 113 843 3 17
Genomic Location (Zv9):
Chromosome 25 (position 5047972)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13639476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCACTATATTTTCAGAAGTTTGTAAGCACCACCTTGCGAAGCTCCT[T/G]ACTTCCATATCCTGAGCTTTACGATTGGGAAGGATGTGCCAGTTTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109207 Essential Splice Site 487 843 10 17
Genomic Location (Zv9):
Chromosome 25 (position 5043716)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13643732
KASP Assay ID:
2261-9315.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTGACAACTGAGCATTTTAGACCTGGAAGAAGTGATGCTCTTAAATG[T/A]AATCAAACACACATTTAATTAGTTTCTGATGTCAAAACTTGCCTGAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link